Medires Publishers - Article

Abstract

Background: Deep vein throm¬bosis (DVT) is serious disorders contributing to increased morbidity and mortality worldwide. However, there is, little genetic data from Africa including Sudan. So this study was conducted to investigate the relationship between genetic mutations G20210A in the prothrombin coagulation factor and deep venous thrombosis in Sudanese patients. 
Methods: This is a cross-sectional study design was carried out in Khartoum state in the period from December 2014 to May 2018. One hundred of patient group and fifty healthy one were enrolled in this study. Mutation was detected using conventional PCR depending on restriction enzyme polymorphism technique.
Results: The mutant allele (G/G) was found in 4 (4%) of patients nevertheless, there is no mutant allele was present in control group (P.value=0.152).  Moreover, the mixed allele (G/A) was not detected in patients and healthy control. Exclusively, the control group showed only the wild type (A/A).
Conclusion: This study noted a few mutant alleles in patients group and only the wild type (A/A) in control one. However, carrying out a genome-wide associated study is recommended to determine relationship between prothrombin gene mutation and frequency of deep vein throm¬bosis in Sudanese population.
 

Introduction

Efficient hemostasis is a rapid and localized response to an interruption in vascular integrity (vessel wall injury); such that clots are formed only when and where they are needed (1). There are three possible contributors to formation of an abnormal clot (thrombus): decreased blood flow, vessel injury or inflammation, and changes in the intrinsic properties of the blood. Persistent physiologic changes in any of these three factors (the Virchow triad) are referred to as hypercoagulable state (2). Hypercoagulable or thrombophilia state is an inherited or acquired abnormality of hemostasis that affects the delicate balance between procoagulant and anticoagulant factors, predisposing to thrombosis (3). Thrombosis can be venous or arterial(4). 
Venous thromboembolism (VTE) is a disease that includes both deep vein thrombosis (DVT) and pulmonary embolism (PE). It is a common, lethal disorder that affects both hospitalized and nonhospitalized patients (5). Although, DVT and PE are two clinical presentations of VTE that share the same predisposing factors (6). Additionally, Deep vein thrombosis can lead to life-threatening pulmonary embolism (7).
Interestingly, the prothrombotic mutation found to be associated with increased prothromhin levels and a 3-fold risk of venous thrombosis (8). Because, prothrombin is an inactive precursor of thrombin, which is the end product of coagulation cascade. Thus, the prothrombotic mutation occurred as results of nucleotide replacement of guanine (G) with adenine (A) at position 20210 in the sequence of the 3'-untranslated region of the gene encoding prothrombin (8). 
Currently, there is growing need to understand the molecular mechanism that controls the relationship between inheritance diseases and many causing factors, so, this study carried out in Sudan to better understand the association between G20210A mutation and deep vein thrombosis in Sudanese patients.

PATIENTS AND METHODS

One hundred and fifty unrelated participants were randomly selected. Of the 150 participants one hundred volunteers diagnosed with deep venous thrombosis (DVT), with the mean age 34.49 years. Fifty healthy volunteers were chosen in accordance to the gender and age of the study group with the mean age 27.02 years.
Blood samples
Two milliliter of whole blood were collected and poured in ethylenediamine tetra acetic acid (EDTA) container and stored at minus eighty degrees tell the time of used for the molecular examinations.
DNA extraction protocol
The genomic DNA was isolated from peripheral blood leucocytes according to Guanidine chloroforme Extraction Method. 
Primers design and preparation
Primers used were described by (Farah Parveen et al. 2013) (9); then checked by NCBI programme:  Forward primer 5ʹTCTAGAAACAGTTGCCTGGC3ʹ and the reverse prime 5ʹGTAGTATTACTGGCTCTTCCTGAG3ʹ 
PCR protocol
Detection of prothrombin gene polymorphism was done according to method described by Farah Parveen et al(9). The amplified fragment of 345 bp was digested by 5 U/sample of Hind III enzyme at 37 0C for 18 hours. The 20210A allele generated a restriction site in the amplified fragment and was digested into two fragments of 322 and 23 bp, respectively. Wild-type allele (20210G) lacked the restriction site and therefore remained undigested (345 bp). (Farah Parveenet al). Presence of 20210GA allele was screened by PCR followed by Hind III enzyme digestion. The PCR conditions were as follow: initial denaturation at 95 0C for 5 minutes, 35 cycle of 94 0C for 30 seconds, 59.3 0C for 45 seconds, 72 0C for 1 minute followed by final extension of 72 0C for 5 minutes.
Detection of PCR products
The PCR product was checked on 2.0 % agarose gel at 120 V for 60 minutes stained with 0.5 lg/mL ethidium bromide in Tris. 

RESULTS

Prothrombin G20210A mutation was detected in 4% (4/100) of DVT patients. The prevalence of the homozygous type (GG) was 4% the heterozygous type was not detect. Both the homozygous and heterozygous were not detected in the control group (Table 3.1). The relation between DVT and this mutation was statically insignificant (P= 0.152).
Prothrombin G20210A mutation was detected in 4% (4/100) of DVT patients. The prevalence of the homozygous type (GG) was 4% the heterozygous type was not detect. Both the homozygous and heterozygous were not detected in the control group (Table.1). The relation between DVT and this mutation was statically insignificant (P= 0.152).
Table 1: Frequency and percentages of mutations in patient and control group

DISCUSSION

The results of the present study illustrate four individuals (4%) of the study group had mutant allele (A/A) for the prothrombin mutation G20210A. The remaining 96 (96%) had the wild type (G/G). results didn’t show the mixed allele (G/A).  The mutant allele and the mixed allele were not found in the control group. The difference between study group and control group was insignificant (P = 0.197) indicating that no association between this mutation and DVT. These findings are supported by a study conducted in Sudan (Yousif et al., 2017) (10) who didn’t detect the mutation in both study and control group (10). The absence of this mutation was also supported by similar findings in a study carried out in Saudi Arabia (Algari et al., 2017) (11); they found no association between this mutation and DVT patients (P-value˃0.05) (11). In France (Meyer et.al, 2001) found results that were consistent with our results. The mutant allele found in 8 % of their study group (DVT patients) but the association was insignificant (P =0.2) (12).
Nevertheless, our results didn’t agree with a study done in turkey by Dölek and his colleague; they found 8.6 % of the study group having the mutant allele while the mutant allele represented 1.8 % of the control group. They concluded that there was association between factor II mutation and DVT (Dölek et. al, 2007). Also, our results are similar to that finding noted by Martinelli and others in Italy they found the mutant allele in 9.4 % of patients and 2.5 % in the control group. They presumed that the mutation is significant if it is combined with acquired factor (14). The study concluded that no association between prothrombin mutation G20210A and DVT.

CONCLUSION

The present study noted that a few mutant alleles in patients group and only the wild type (A/A) in control one. However, carrying out a genome-wide associated study is recommended to determine relationship between prothrombin gene mutation and frequency of deep vein throm¬bosis in Sudanese population.

RECOMMENDATION

We recommended that further study may be carried and large sample should be taken into account.
FUNDING 
Authors did not receive neither financial nor non-financial funding for conducting and publishing this work.
ETHICAL APPROVAL AND CONSENT 
The study was approved by the research committee at the faculty of medical laboratory science, Managil University of Science & Technology. Ethical approval was achieved from the university, Informed consents were taken from each subject before enrollment in the study.
ACKNOWLEDGMENTS 
Authors gratefully acknowledge all people work and help us in this study.
COMPETING INTERESTS 
Authors have declared that no competing interests exist.

References

1. Michael L. et al. The Diagnosis of Disease in the Clinical Laboratory. Laboratory Medicine, 2nd edition: pages, 2014. McGraw-Hill Education.
   View at Publisher | View at Google Scholar
2. Gary D. Hammer and Stephen J. An Introduction to Clinical Medicine. Pathophysiology of Disease: 7th edtion, pages, 2014. McGraw-Hill Education.
   View at Publisher | View at Google Scholar
3. Siniša P, Nebojša S, Miroslav P, Miloš S, Predrag Đ and Nikola I. Vascular graft thrombosis secondary to activated protein C resistance: a case report and literature review. Vascular, 22 (1): 71-76, 2014.
   View at Publisher | View at Google Scholar
4. Tommaso Za et al. Arterial and venous thrombosis in patients with monoclonal gammopathy of undetermined significance: incidence and risk factors in a cohort of 1491 patients. British Journal of Haematology, 160: 673–679, 2013.
   View at Publisher | View at Google Scholar
5. Antonio-Javier C et al. Association of allelic variants of factor V Leiden, prothrombin and methylenetetrahydrofolate reductase with thrombosis or ocular involvement in Behçet's disease: A systematic review and meta-analysis. Autoimmunity Reviews, 12 :607–616, 2013.
   View at Publisher | View at Google Scholar
6. Bruni-F, Karen R.venous thromboembolism: an ovrview. Journal of Vascular Nursing, 33(3):95-99, 2015.
   View at Publisher | View at Google Scholar
7. Julian P. C, Zenobia D, Robert K, Chenghui L, Jennifer Cai, and Ronald P. Economic burden of recurrent venous thromboembolism: Analysis from a U.S. Hospital perspective. American Journal of Health, 72:291-300, 2015.
   View at Publisher | View at Google Scholar
8. Julide A, Omer A, Turgut U, Mujgan C, and Nur B. Factor V Leiden, Prothrombin G20210A, and Protein C Mutation Frequency in Turkish Venous Thrombosis Patients. Clinical and Applied Thrombosis/Hemostasis, 14 (4): 415-420, 2008.
   View at Publisher | View at Google Scholar
9. Farah Parveen, Anju Shukla, and Suraksha Agrawal. Should factor V Leiden mutation and prothrombin gene polymorphism testing be done in women with recurrent miscarriage from North India. Archives of Gynecology and Obstetrics. 287:375–381. 2013.
   View at Publisher | View at Google Scholar
10. Yousif AA, Muddathir AM, Elamin EM and Alhadi A. The Role of Factor V Leiden 1691G>A and Prothrombin Gene 20210G>A Mutations in Hypercoagulable State Associated with Venous Thromboembolism among Sudanese Patients. Blood Disorders and Transfusion.8(3):386.2017.
    View at Publisher | View at Google Scholar
11. Yousif AA, Muddathir AM, Elamin EM and Alhadi A. The Role of Factor V Leiden 1691G>A and Prothrombin Gene 20210G>A Mutations in Hypercoagulable State Associated with Venous Thromboembolism among Sudanese Patients. Blood Disorders and Transfusion.8(3):386.2017.
    View at Publisher | View at Google Scholar
12. Algari MM, Ibrahim NA, Mudathir AM, Eltoom FM and Ibrahim IM. Frequency of Gene Mutations in Patients with Deep Vein Thrombosisin women with Recurrent Pregnancy Loss. Open life science.12:162-166.2017.
    View at Publisher | View at Google Scholar
13. Meyer G et.al. Factors V Leiden and II 20210A in Patients with Symptomatic Pulmonary Embolism and Deep Vein Thrombosis. The American Journal of Medicine, 110:12-15.2001.
    View at Publisher | View at Google Scholar
14. Dölek B et. al. Molecular Analysis of Factor V Leiden, Factor V Hong Kong, Factor II G20210A, Methylenetetrahydrofolate Reductase C677T, and A1298C Mutations Related to Turkish Thrombosis Patients. Clinical and Applied Thrombosis/Hemostasis. 13(4): 435-438.2007.
    View at Publisher | View at Google Scholar